FASTA is a program used to search in large Protein or DNA sequence data banks. It was developed at the University of Virginia by William R. Pearson, and D.J. Lippman.
FASTA is installed in /opt/Bio/fasta/. FASTA is run in a similar manner to NCBI Blast.
First create a test query file
[nostromo@xxx ~]$ cat > test.txt >Test AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC TTCTGAACTGGTTACCTGCCGTGAGTAAATTAAAATTTTATTGACTTAGGTCACTAAATACTTTAACCAA TATAGGCATAGCGCACAGACAGATAAAAATTACAGAGTACACAACATCCATGAAACGCATTAGCACCACC ATTACCACCACCATCACCATTACCACAGGTAACGGTGCGGGCTGACGCGTACAGGAAACACAGAAAAAAG CCCGCACCTGACAGTGCGGGCTTTTTTTTTCGACCAAAGGTAACGAGGTAACAACCATGCGAGTGTTGAA GTTCGGCGGTACATCAGTGGCAAATGCAGAACGTTTTCTGCGTGTTGCCGATATTCTGGAAAGCAATGCC AGGCAGGGGCAGGTGGCCACCGTCCTCTCTGCCCCCGCCAAAATCACCAACCACCTGGTGGCGATGATTG AAAAAACCATTAGCGGCCAGGATGCTTTACCCAATATCAGCGATGCCGAACGTATTTTTGCCGAACTTTT |
The next step is to search for this against a database sequence. For this, we can download a DNA or protein sequence database or use the ones that are provided by the program. For this example, we will use the ones present along with the fasta program in /opt/Bio/fasta/.
[nostromo@xxx ~]$ fasta35 # fasta35 FASTA searches a protein or DNA sequence data bank version 35.04 Oct. 7, 2008 Please cite: W.R. Pearson & D.J. Lipman PNAS (1988) 85:2444-2448 test sequence file name: test.txt library file name: drosoph.nt ktup? (1 to 6) [6] Query: test.txt 1>>>Test - 560 nt Library: drosoph.nt ....... Done! 122655632 residues in 1170 sequences opt E() < 20 0 0: 22 0 0: one = represents 3 library sequences 24 0 0: 26 0 0: 28 0 0: 30 3 2:* 32 12 9:==*= 34 37 23:=======*===== 36 59 48:===============*==== 38 90 79:==========================*=== 40 110 110:====================================* 42 133 135:============================================* 44 147 149:=================================================* 46 151 151:==================================================* 48 129 145:=========================================== * 50 131 132:===========================================* 52 102 116:================================== * 54 92 99:=============================== * 56 80 83:===========================* 58 68 68:======================* 60 43 55:=============== * 62 44 44:==============* 64 42 35:===========*== 66 30 28:=========* 68 25 22:=======*= 70 20 17:=====*= 72 18 13:====*= 74 14 10:===*= 76 7 8:==* 78 7 6:=*= 80 9 5:=*= 82 3 4:=* 84 0 3:* 86 0 2:* 88 2 2:* inset = represents 1 library sequences 90 1 1:* 92 0 1:* :* 94 0 1:* :* 96 2 1:* :*= 98 0 0: * 100 0 0: * 102 0 0: * 104 0 0: * 106 0 0: * 108 0 0: * 110 0 0: * 112 0 0: * 114 0 0: * 116 0 0: * 118 0 0: * >120 0 0: * 122902592 residues in 1611 sequences Statistics: Expectation_n fit: rho(ln(x))= 7.6751+/-0.00204; mu= 6.7759+/- 0.231 mean_var=233.8700+/-93.821, 0's: 0 Z-trim: 0 B-trim: 0 in 0/53 Lambda= 0.083866 Kolmogorov-Smirnov statistic: 0.0247 (N=27) at 38 Algorithm: FASTA (3.5 Sept 2006) [optimized] Parameters: +5/-4 matrix (5:-4) ktup: 6 join: 52, opt: 37, open/ext: -12/-4, width: 16 Scan time: 10.680 Enter filename for results []: How many scores would you like to see? [20] The best scores are: opt bits E(1611) gi|10727961|gb|AE003541.2|AE003541 Drosophila (265536) [r] 171 36.0 1 gi|10728546|gb|AE003447.2|AE003447 Drosophila (304085) [f] 171 36.0 1 gi|7290382|gb|AE003426.1|AE003426 Drosophila m (300193) [f] 159 34.5 2.8 gi|7290880|gb|AE003443.1|AE003443 Drosophila m (302357) [f] 157 34.3 3.3 gi|10727731|gb|AE003838.2|AE003838 Drosophila (263411) [r] 149 33.3 6.4 gi|7291133|gb|AE003450.1|AE003450 Drosophila m (300732) [f] 148 33.2 6.9 gi|7300931|gb|AE003741.1|AE003741 Drosophila m (233313) [r] 151 33.2 7.1 gi|10726402|gb|AE003682.2|AE003682 Drosophila (224400) [f] 147 33.1 7.5 gi|10728339|gb|AE003512.2|AE003512 Drosophila (301457) [f] 147 33.1 7.5 gi|10728273|gb|AE003500.2|AE003500 Drosophila (327446) [f] 145 32.8 8.9 gi|10726452|gb|AE003691.2|AE003691 Drosophila (226773) [f] 145 32.8 8.9 gi|10727164|gb|AE003603.2|AE003603 Drosophila (294914) [r] 144 32.6 10 gi|7290252|gb|AE003423.1|AE003423 Drosophila m (291976) [r] 144 32.6 10 gi|10727489|gb|AE003803.2|AE003803 Drosophila (282567) [r] 143 32.6 10 gi|10727489|gb|AE003803.2|AE003803 Drosophila (282567) [r] 143 32.5 11 gi|10727339|gb|AE003577.2|AE003577 Drosophila (267662) [f] 142 32.3 13 gi|7292734|gb|AE003488.1|AE003488 Drosophila m (302797) [f] 140 32.2 13 gi|7298684|gb|AE003667.1|AE003667 Drosophila m (263704) [r] 139 31.9 17 gi|10727995|gb|AE003546.2|AE003546 Drosophila (281602) [f] 137 31.9 17 gi|10728551|gb|AE003448.2|AE003448 Drosophila (310364) [f] 137 31.9 18 More scores? [0] Display alignments also? (y/n) [n] 560 residues in 1 query sequences 122655632 residues in 1170 library sequences Scomplib [35.04] start: Wed Dec 10 19:45:41 2008 done: Wed Dec 10 19:46:04 2008 Total Scan time: 10.680 Total Display time: 0.000 Function used was FASTA [version 35.04 Oct. 7, 2008] |
Further information about the usage of fasta can be obtained from /opt/Bio/fasta/fasta3x.doc present on the frontend of your installation.
More information is also available at the FASTA home page.
For support, you are encouraged to join the FASTA mailing list at http://list.mail.virginia.edu/mailman/listinfo/fasta_list