FASTA is a program used to search in large Protein or DNA sequence data banks. It was developed at the University of Virginia by William R. Pearson, and D.J. Lippman.
FASTA is installed in /opt/Bio/fasta/. FASTA is run in a similar manner to NCBI Blast.
First create a test query file
[nostromo@xxx ~]$ cat > test.txt >Test AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC TTCTGAACTGGTTACCTGCCGTGAGTAAATTAAAATTTTATTGACTTAGGTCACTAAATACTTTAACCAA TATAGGCATAGCGCACAGACAGATAAAAATTACAGAGTACACAACATCCATGAAACGCATTAGCACCACC ATTACCACCACCATCACCATTACCACAGGTAACGGTGCGGGCTGACGCGTACAGGAAACACAGAAAAAAG CCCGCACCTGACAGTGCGGGCTTTTTTTTTCGACCAAAGGTAACGAGGTAACAACCATGCGAGTGTTGAA GTTCGGCGGTACATCAGTGGCAAATGCAGAACGTTTTCTGCGTGTTGCCGATATTCTGGAAAGCAATGCC AGGCAGGGGCAGGTGGCCACCGTCCTCTCTGCCCCCGCCAAAATCACCAACCACCTGGTGGCGATGATTG AAAAAACCATTAGCGGCCAGGATGCTTTACCCAATATCAGCGATGCCGAACGTATTTTTGCCGAACTTTT |
The next step is to search for this against a database sequence. For this, we can download a DNA or protein sequence database or use the ones that are provided by the program. For this example, we will use the ones present along with the fasta program in /opt/Bio/fasta/.
[nostromo@xxx ~]$ fasta34 # fasta34 FASTA searches a protein or DNA sequence data bank version 3.4t25 Sept 2, 2005 Please cite: W.R. Pearson & D.J. Lipman PNAS (1988) 85:2444-2448 test sequence file name: test.txt library file name: /opt/Bio/fasta/gst.seq ktup? (1 to 6) [6] 1 Query library test.txt vs /opt/Bio/fasta/gst.seq library searching /opt/Bio/fasta/gst.seq library 1>>>Test - 560 nt vs /opt/Bio/fasta/gst.seq library 1287 residues in 1 sequences Altschul/Gish params: n0: 560 Lambda: 0.192 K: 0.177 H: 0.360 FASTA (3.47 Mar 2004) function [optimized, +5/-4 matrix (5:-4)] ktup: 1 join: 77, opt: 62, open/ext: -12/-4, width: 16 Scan time: 0.000 Enter filename for results []: res.txt How many scores would you like to see? [20] The best scores are: opt bits E(1) gi|193547|gb|J04632|MUSGLUTA Mouse glutathione (1287) [r] 68 21.5 0.22 gi|193547|gb|J04632|MUSGLUTA Mouse glutathione (1287) [f] 62 19.8 0.55 More scores? [0] Display alignments also? (y/n) [n] y number of alignments [20]? 560 residues in 1 query sequences 1287 residues in 1 library sequences Scomplib [34t25] start: Wed Mar 15 16:14:08 2006 done: Wed Mar 15 16:14:51 2006 Total Scan time: 0.000 Total Display time: 0.010 Function used was FASTA [version 3.4t25 Sept 2, 2005] |
Looking into res.txt we can see the results of our search.
Further information about the usage of fasta can be obtained from /opt/Bio/fasta/fasta3x.doc present on the frontend of your installation.
More information is also available at the FASTA home page.
For support, you are encouraged to join the FASTA mailing list at http://list.mail.virginia.edu/mailman/listinfo/fasta_list